circad | circRNAs associated with diseases

hsa_circ_0007534
Gene	DDX42	Organism	Human
Genome Locus	chr17:61869771-61877977:+	Build	hg19
Disease	Cervical Cancer	ICD-10	Malignant neoplasm of cervix uteri (C53)
DBLink		PMID	31445025
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Forty-five pairs of cervical cancer tissues and adjacent, normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGACGGAAATCCAATTGCACC Reverse ATGGAATTGCTGGCGAGTTG	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Rong, X, Gao, W, Yang, X, Guo, J (2019). Downregulation of hsa_circ_0007534 restricts the proliferation and invasion of cervical cancer through regulating miR-498/BMI-1 signaling. Life Sci., 235:116785.